Mismatch Repair Involves The Methylation Of Which Combination Of 4 Nucleotides?

• Loading metrics

Open Access

Peer-reviewed

Research Article

Nucleotide Excision Repair, Mismatch Repair, and R-Loops Attune Convergent Transcription-Induced Cell Expiry and Echo Instability

• John H. Wilson

Nucleotide Excision Repair, Mismatch Repair, and R-Loops Modulate Convergent Transcription-Induced Jail cell Death and Repeat Instability

• Yunfu Lin,
• John H. Wilson

ten

• Published: October iii, 2022
• https://doi.org/x.1371/journal.pone.0046807

Figures

Abstract

Expansion of CAG•CTG tracts located in specific genes is responsible for 13 human neurodegenerative disorders, the pathogenic mechanisms of which are non all the same well defined. These affliction genes are ubiquitously expressed in human tissues, and transcription has been identified as one of the major pathways destabilizing the repeats. Transcription-induced echo instability depends on transcription-coupled nucleotide excision repair (TC-NER), the mismatch repair (MMR) recognition component MSH2/MSH3, and RNA/Dna hybrids (R-loops). Recently, nosotros reported that simultaneous sense and antisense transcription–convergent transcription–through a CAG repeat not only promotes repeat instability, but as well induces a cell stress response, which arrests the cell cycle and somewhen leads to massive cell death via apoptosis. Here, we use siRNA knockdowns to investigate whether NER, MMR, and R-loops besides modulate convergent-transcription-induced cell death and repeat instability. We find that siRNA-mediated depletion of TC-NER components increases convergent transcription-induced cell death, as does the simultaneous depletion of RNase H1 and RNase H2A. In contrast, depletion of MSH2 decreases cell death. These results identify TC-NER, MMR recognition, and R-loops as modulators of convergent transcription-induced prison cell death and shed light on the molecular mechanism involved. Nosotros also find that the TC-NER pathway, MSH2, and R-loops modulate convergent transcription-induced repeat instability. These observations link the mechanisms of convergent transcription-induced repeat instability and convergent transcription-induced cell decease, suggesting that a common construction may trigger both outcomes.

Citation: Lin Y, Wilson JH (2012) Nucleotide Excision Repair, Mismatch Repair, and R-Loops Modulate Convergent Transcription-Induced Cell Expiry and Repeat Instability. PLoS ONE 7(10): e46807. https://doi.org/10.1371/journal.pone.0046807

Editor: Tetsuo Ashizawa, Academy of Florida, The states of America

Received: May 1, 2022; Accustomed: September seven, 2022; Published: October 3, 2022

Copyright: © Lin, Wilson. This is an open up-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in whatever medium, provided the original author and source are credited.

Funding: This work was supported past a grant from the NIH (GM38219) to J.H.W. The funders had no office in study design, data collection and analysis, conclusion to publish, or preparation of the manuscript.

Competing interests: The authors accept alleged that no competing interests exist.

Introduction

Tandem repetitive sequences, which are the major constituents of the telomeres and centromeres of chromosomes, are distributed throughout the human genome [one]. Expansions of CAG•CTG tracts in any 1 of several specific human genes lead to disorders, typically characterized by neurodegeneration, due to loss or death of neurons in disease-specific regions of the encephalon. So far, thirteen trinucleotide (TNR) disorders accept been found to be caused by expansion of a CAG•CTG tract, including Huntington disease (HD), Hd-like 2 (HDL2), myotonic dystrophy type 1 (DM1), spinal and bulbar muscular atrophy (SBMA), dentatorubral-pallidoluysian atrophy (DRPLA), and the spinocerebellar ataxias SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA12, and SCA17 [2], [3], [4]. The molecular footing for these CAG repeat diseases (CAG diseases, hereafter) is the expansion of a repeat tract beyond a disease-specific threshold number of repeat units. For reasons that are not entirely articulate, long CAG repeat tracts become unstable, with a strong bias toward expansion, both in germline and somatic cells [5]. Expansion in the germline leads to longer repeats in the progeny, along with increased disease severity and earlier age of onset of illness symptoms, while expansion in somatic cells, particularly in neurons, accelerates disease progression [3], [four], [6], [7].

One critical topic for agreement and treating CAG diseases is the mechanism of CAG echo expansion during germline manual and in somatic cells. Using bacteria, yeast, flies, mammalian cells, and mouse model systems, previous studies have shown that echo instability can occur in connection with virtually any Dna metabolic pathway, including Dna replication, DNA repair, recombination, and transcription [half-dozen], [viii], [9], [10], [xi], [12]. These processes may vary in their relative importance to repeat instability in dissimilar prison cell types in humans [3], [5], [13]. For instance, DNA replication is expected to be a more than of import contributor to echo instability in proliferating germ cells than in terminally differentiated neurons [12]. Several genetic observations in mouse models back up the idea of multiple, tissue-specific mechanisms for repeat instability: deletion of one copy of the Dnmt1 (Deoxyribonucleic acid methyltransferase one) gene increases instability in the male and female person germlines, only not in somatic cells [14]; nulls for a component of base of operations excision repair, Ogg1 (8-oxoguanine glycosylase), reduce instability in somatic tissues, but do not touch on the germline [15], [16]; and knockout of the Xpa factor–which encodes a central component of nucleotide excision repair (NER)–virtually eliminates echo instability in several specific brain regions, just does not affect instability in liver, kidney, or either germline [17]. These studies indicate that distinct pathways are involved in driving repeat instability in specific tissues.

Studies in human cells and Drosophila initially showed that transcription, in clan with Deoxyribonucleic acid repair, promotes CAG instability in eukaryotic cells [18], [19]. It is idea that transcription, by transiently exposing single Deoxyribonucleic acid strands, allows long CAG repeat tracts to class abnormal secondary structures such as hairpins and slipped-strand DNA duplexes, which then engage Deoxyribonucleic acid repair processes [20], [21]. Detailed studies in human cells have shown that transcription-coupled nucleotide excision repair (TC-NER), which specifically removes Deoxyribonucleic acid lesions that block RNA polymerase Ii (RNAPII), plays a critical role in destabilizing repeats [22], [23]. A contempo biochemical study in cell-gratuitous extracts has provided support for our genetic observations, by showing that repeat hairpins on either the transcribed or not-transcribed strands can arrest RNAPII [24]. Interestingly, hairpins alone exercise not abort pure T7 RNAP, but require additional components in the nuclear extract [24]. The mismatch repair (MMR) recognition complex MSH2/MSH3 is a stiff candidate for this activity because it binds to CAG and CTG hairpins [25], [26], plays a crucial part in CAG repeat instability in mice [27], [28], [29], [30], and promotes transcription-induced repeat instability in human cells [xviii], [31]. In addition, we have identified other modulators of transcription-dependent repeat instability in human being cells that may also contribute, including RNA/Dna hybrids (R-loops) [32], the proteasome machinery [23], and the unmarried-strand break repair (SSBR) pathway [33]. These studies indicate that the CAG repeat instability triggered by transcription results from a complex molecular process.

To add to this complexity, 2 recent papers reported that simultaneous sense and antisense transcription–convergent transcription–through a CAG tract destabilizes the repeats in human cells [34], [35], with larger furnishings than the sum of sense and antisense transcription alone [35]. The mechanism for convergent transcription-induced repeat instability has not been characterized, merely it could plausibly involve the same Deoxyribonucleic acid processes equally sense transcription. Convergent transcription, withal, not only promotes echo instability, it also triggers cell-cycle arrest and massive apoptosis-dependent prison cell death via a DNA damage-similar response involving the ATR pathway and its downstream targets such every bit jail cell-cycle checkpoint kinase 1 (CHK1) and p53 [35]. In this study, we used siRNA knockdown to define the roles of Deoxyribonucleic acid repair components in convergent transcription-induced echo instability and prison cell death. We notice that depletion of MSH2 decreases echo instability and jail cell death, while depletion of RNase H increases both instability and expiry. In contrast, depletion of XPA decreases instability, but increases jail cell death. The possible roles of these proteins in convergent transcription-induced jail cell death and echo instability are discussed.

Materials and Methods

Cell Lines and Cell Civilisation

The structure of DIT7 cells was described previously [35]. Briefly, RS11 cells express the rtTA poly peptide, a fusion of the contrary tetracycline repressor poly peptide and the HSV VP16 transcription activation domain, which drives expression from the pTRE-CMV^mini promoter in the presence of the inducer, doxycycline. RS11 cells also contain genes for RheoReceptor-ane and RheoActivator, which drive expression from the pNERB-X1 promoter in the presence of the inducer, RSL1. DIT7 cells were derived from RS11 cells by integration of a single copy of an HPRT minigene carrying a CAG₉₅ tract in its intron, with sense and antisense transcription controlled by the promoters pTRE-CMV^mini and pNERB-X1, respectively (Figure 1). Sense transcription of the HPRT minigene in DIT7 cells is induced 22-fold with doxycycline, and antisense transcription is induced sixteen-fold with RSL1 [35]. DIT7-R103 cells were derived from DIT7 by wrinkle of the CAG repeat tract from 95 to fifteen units [35]. Both DIT7 and DIT7-R103 cells were grown at 37°C with 5% CO₂ in DMEM/F-12 medium supplemented with ten% fetal bovine serum and 1% MEM nonessential amino acids.

Effigy 1. Construction of the HPRT minigenes in DIT7 and DIT7-R103 cells.

DIT7 cells carry a CAG₉₅ repeat tract and DIT7-R103 cells, which were derived from DIT7 cells by contraction of the repeat, behave a CAG₁₅ repeat tract. In both cell lines, the CAG tract is centered in the two.ane-kb intron in the single, randomly integrated HPRT minigene. The CAG repeat is about one.half dozen kb downstream of the sense promoter and about two.5 kb upstream of the antisense promoter.

https://doi.org/10.1371/periodical.pone.0046807.g001

Induction of Transcription

Cells were grown and maintained in the absence of transcription inducers. For all experiments, transcription was induced past addition of inducers on day 0. Sense transcription of the HPRT minigene was induced by addition of doxycycline at a terminal concentration of 0.two µg/mL. Because the half-life of doxycycline in medium is nigh 24 hours, 0.ane µg/mL of doxycycline was added into the medium each day until the treatment was completed. Antisense transcription was induced by addition of RSL1 at a final concentration of 500 nM. No additional RSL1 was required.

siRNA Treatment

Near 100,000 cells were plated in each well of a 6-well plate on day −three. On day −ii, cells were transfected with individual siRNAs at a final concentration of 200 nM, using oligofectamine (Invitrogen). Treatments with 200 nM vimentin siRNA served as controls. Treatment with vimentin siRNA does non affect the cells; information technology does not modify the per centum of DIT7 and DIT7-R103 cells that die when convergent transcription is induced. On day 0, cells were over again transfected with siRNA, and cultures were then grown in the presence or absence of doxycycline plus RSL1. The efficiency of knockdown of target genes was determined on solar day +1 for private siRNAs using real-fourth dimension RT-PCR, as described previously [23], [32]. All siRNAs used in this report lowered the efficiency of target gene expression by at least 70%. Singled-out siRNAs that are targeted to different regions of the same gene are labeled −ane and −two; for instance, XPA-ane and XPA-2 signal 2 different siRNAs against the XPA gene. The sequences of these siRNAs and RT-PCR primers are identical to those used previously [23], [32].

Measurements of Dead Cells and Viable Cells

We define adherent cells (attached to the plate) as viable cells, and nonadherent cells (present in the medium) as dead cells [35]. Previously, we showed that fewer than 4% of adherent cells incorporated propidium iodide, indicating that greater than 96% of adherent cells are viable [35]. By dissimilarity, more than 99% of nonadherent cells stained with propidium iodide. The small contamination of nonadherent cells by alive cells (and of adherent cells by expressionless cells) was ignored in all experiments.

After the 2nd transfection with siRNA on day 0, cells were grown in the presence or absenteeism of doxycycline and RSL1 for 4 days, at which time viable (adherent) and dead (nonadherent) cells were determined. The number of dead cells was measured by counting several m nonadherent cells in the medium using a Coulter cell counter. The number of viable cells was counted in the same style subsequently detachment of adherent cells from the dish by trypsin handling. The percentage of dead cells was calculated as the number of nonadherent cells divided by the total number of adherent plus nonadherent cells. Each assay consists of the results for a unmarried well in a six-well plate, which typically contains 0.five to 1 million cells at the time of the assay. At least half dozen independent assays were carried out for each siRNA knockdown experiment and the results were averaged and standard deviations were determined.

Wrinkle Assay

As described previously, the DIT7 cells used in the contraction assay carry an integrated re-create of the HPRT minigene, whose expression is under control of the Tet-ON promoter [35]. The CAG₉₅ repeat located in the intron inactivates the minigene by causing aberrant splicing of the mRNA, rendering the poly peptide nonfunctional. Contraction of the echo to less than 39 units allows sufficient correct splicing to requite normal HPRT function. This selection assay measures contractions of 56 to 95 repeat units. In the text nosotros refer to these events specifically as repeat contractions and generically as repeat instability.

For wrinkle assays, subsequently the 2nd transfection with siRNA on twenty-four hour period 0, DIT7 cells were grown in the presence or absence of doxycycline and RSL1 for 2 days. The cells were then re-fed with fresh medium defective inducers and allowed to recover for one day. On day 3 cells were plated in HAT selection medium (0.1 mM hypoxanthine, 0.4 µM aminopterin, and 16 µM thymine) supplemented with doxycycline at a cell density of 500,000 cells per ten-cm dish and allowed to form colonies. Contraction frequencies were calculated as the number of HPRT⁺ colonies divided by the number of viable cells; they are the boilerplate of at least 6 experiments.

In Vitro Binding and Western Blotting

To test in vitro bounden, nosotros designed the following 4 DNA oligos: 13-4 CGGCGCTGGGCGCGCACCGAG(CAG)_thirteen GATCCTCGAGCTGGTCCCGCAGGC; 13-five CGGCGCTGGGCGCGCACCGAG(CTG)_xiii GATCCTCGAGCTGGTCCCGCAGGC; 13-vii CGGCGCTGGGCGCGCACCGAGGATCCTCGAGCTGGTCCCGCAGGC; and 13-6bait GCCTGCGGGACCAGCTCGAGGATCCTGCTCGGTGCGCGCCCAGCGCCG-Bio. Annealing xiii-6bait with 13-four, 13-5 or 13-7 at a molar ration of 1∶4 forms double strand Dna fragments that contain a CAG₁₃ hairpin, a CTG₁₃ hairpin, or no hairpin, respectively. These pairs of Dna oligos were incubated with streptavidin magnetic particles (Roche) at room temperature for 30 min with gentle shaking. The beads were washed twice with washing buffer (10 mM Tris-HCl, i mM EDTA, 100 mM NaCl, pH 7.5), twice with PBS containing 1% NP-40, and and so resuspended in 400 µL PBS containing 1% NP-40. 600 µL of 10% milk were added and the solution was shaken gently at room temperature for 2 hr. The chaplet were then washed four times with PBS containing 0.5% NP-40. For binding, the beads were resuspended in 400 µL PBS with 1% NP-twoscore, near 150 µg of whole cell extract was added, and the mixture was gently shaken for ii hours at room temperature. Chaplet were washed 4 times by resuspension in PBS containing 0.5% NP-xl followed by centrifugation at 3000 rpm for i minute. Proteins bound to the beads were eluted by improver of sixty µL of Western absorb loading buffer (50 mM Tris pH 6.8, 100 mM DTT, ii% SDS, 0.1% Bromophenol Blue, 10% Glycerol), followed by brief vortexing, incubated at 95°C for 5 minutes, and so centrifuged at 8,000 rpm for 1 min. The supernatant was carefully removed for Western blot analysis. 10 µL of the supernatant was loaded in each lane of 10% SDS/PAGE gels, and 5 µg of whole cell excerpt was loaded in an next lane to serve as a reference. After the gels were subjected to electrophoresis, the proteins were transferred to polyvinylidene difluoride membranes and incubated with XPA (Santa Cruz) or actin (Sigma) antibodies. Immunoblots were then visualized using an enhanced ECL kit (GE Healthcare).

Statistics

Statistical analyses of significance were conducted using Student'south t-test to compare the ways and standard deviations, which were derived from multiple experiments.

Results

TC-NER Protects against Convergent Transcription-induced Cell Death

We had speculated previously that the stalling of RNAPII at CAG repeats during convergent transcription triggers the cellular stress response that leads to cell expiry [35], [36]. Since TC-NER functions to remove the hairpins that stall RNAPII, we expected that decreasing the effectiveness of TC-NER would lead to more than persistent RNAPII stalling and exacerbate convergent transcription-induced cell death.

To test the part of TC-NER in convergent transcription-induced cell death, we knocked down 4 NER components with specific siRNAs and measured the frequency of prison cell death in DIT7 and DIT7-R103 cells, each of which contains an integrated HPRT minigene that carries repeat tracts of CAG₉₅ and CAG_xv, respectively (Effigy 1). Because DIT7-R103 cells were derived from DIT7 cells by contraction of the CAG echo, they differ only in the length of the echo tract [35]. As shown previously, these two cell lines differ in their sensitivity to convergent transcription, with DIT7 cells dying most twice as fast every bit DIT7-R103 cells when convergent transcription is induced [35]. The NER factors XPA, ERCC1, and XPG, and the TC-NER-specific factor CSB, are required for transcription-induced CAG instability [xviii], [23]. Treatments with the siRNAs used in this study reduce their target levels by 70% to 90% in human HT1080 cells [xviii], [23], [32]. siRNA knockdown of XPA, CSB, ERCC1, or XPG significantly increased prison cell death in both DIT7 and DIT7-R103 cells (Figure 2). These results suggest that TC-NER pathway commonly functions to protect cells from convergent transcription-induced cell decease, likely by removing the block to the arrested RNAPII complexes, which are the initial triggers for the cell stress response [36].

Figure 2. Effects of knockdown of TC-NER components on convergent transcription-induced cell death.

(A) siRNA knockdowns in DIT7 cells. Frequencies of jail cell death are: vimentin, 47%; XPA-1, 55%; XPA-2, 63%; CSB-1, 52%; CSB-2, 51%; ERCC1-one, 61%; ERCC1-2, 53%; XPG-1, 51%; XPG-2, 57%. (B) siRNA knockdowns in DIT7-R103 cells. Frequencies of cell expiry are: vimentin, 22%; XPA-ane, 33%; XPA-2, 31%; CSB-i, 29%; CSB-2, 26%; ERCC1-ane, 39%; ERCC1-2, 31%; XPG-ane, 25%; XPG-2, forty%. Frequency of cell death was calculated every bit the number of nonadherent cells divided by the sum of adherent and nonadherent cells. Data are the average frequencies of prison cell death from at to the lowest degree half dozen contained siRNA knockdown experiments. Error bars indicate standard deviations. Statistical significance relative to the vimentin control is indicated: *P<0.05; **P<0.001; ***P<0.0001.

https://doi.org/ten.1371/journal.pone.0046807.g002

When the data in Effigy ii are normalized to the vimentin siRNA control for each jail cell line, it is apparent that knockdown of TC-NER components has a greater effect on cell death in DIT7-R103 (CAG₁₅) cells than DIT7 (CAG₉₅) cells (Tabular array 1). Thus a cell line with a shorter CAG tract seems to be more sensitive to decreased TC-NER capacity than one with a longer repeat.

XPA Binds to Hairpins in vitro

Considering TC-NER helps to resolve the issues acquired by convergent transcription, nosotros sought to determine whether a key component, XPA, might demark to repeat hairpins. XPA is known to bind to helical kinks, which may contribute to the way a cell selects the appropriate DNA repair pathway [37]. In improver, UvrA, a nucleotide excision repair component in E.coli, has been shown to bind to CAG hairpins in vitro [38]. To test whether XPA is recruited to the hairpins, we annealed Deoxyribonucleic acid oligos to form a duplex lacking a hairpin, a duplex with a CAG hairpin, or one with a CTG hairpin and so incubated them in a nuclear excerpt equally bounden baits. We and so performed a pull-down assay using XPA-specific antibody. As shown in Figure 3, XPA binds to CAG and CTG hairpins with like efficiency, only does non bind to duplex Dna. These results indicate that XPA is likely to be ane of the proteins associated with echo tract hairpins in cells. Because we used a nuclear extract equally a source of protein, our results do not distinguish between the binding of XPA directly to the hairpins or via association with other proteins.

Figure 3. Binding of XPA to CAG- and CTG-containing Dna duplexes.

Duplexes without hairpins, with a CAG_thirteen hairpin, or a CTG_xiii hairpin were fastened to magnetic beads (see Methods) and incubated with a whole prison cell extract from human cells. The proteins leap to the Dna were then analyzed by Western blot analysis, using antibodies against actin or XPA. Actin served as a command for nonspecific binding. WCE stands for whole jail cell excerpt.

https://doi.org/ten.1371/journal.pone.0046807.g003

MSH2 Promotes Convergent Transcription-induced Cell Death

The MMR recognition circuitous MSH2/MSH3 (MutSβ), which binds to CAG and CTG hairpins in vitro [25], [26], is a likely candidate for the cellular component that stabilizes echo structures to course obstacles for RNAPII [24], [35]. If the stalling of RNAPII is an essential element in the signal for convergent transcription-induced cell death, then nosotros would await that depletion of MSH2/MSH3 should reduce jail cell expiry. To exam this idea, nosotros used siRNAs to knock down MSH2 in DIT7 cells and in DIT7-R103 cells. Equally shown in Effigy 4, treatments with 2 MSH2 siRNAs significantly reduced death in both cell lines. As with the knockdown of TC-NER components, the normalized issue of MSH2 knockdown on cell death was greater in DIT7-R103 (CAG_xv) cells than in DIT7 (CAG₁₅) cells (Tabular array 1).

Figure 4. Effects of MSH2 knockdown on convergent transcription-induced cell death.

(A) siRNA knockdowns in DIT7 cells. Frequencies of cell death are: vimentin, 47%; MSH2-1, 41%; MSH2-2, 42%. (B) siRNA knockdowns in DIT7-R103 cells. Frequencies of prison cell death are: vimentin, 22%; MSH2-1, four%; MSH2-ii, 9%. Frequency of cell expiry was calculated every bit the number of nonadherent cells divided by the sum of adherent and nonadherent cells. Data are the boilerplate frequency of jail cell expiry from at to the lowest degree 6 contained siRNA knockdown experiments. Error confined indicate standard deviations. Statistical significance relative to the vimentin command is indicated: *P<0.05; **P<0.001; ***P<0.0001.

https://doi.org/10.1371/journal.pone.0046807.g004

RNase H Enzymes Reduce Convergent Transcription-induced Cell Death

Nosotros previously showed that extensive RNA/Deoxyribonucleic acid hybrids (R-loops) grade during sense transcription of CAG echo tracts in human cells [32]. RNase H enzymes normally remove the RNA component of R-loops to eliminate the hybrids. Depletion of RNase H1 or RNase H2A, which would prolong the lifetime of R-loops, increases transcription-induced CAG instability in homo cells [32], suggesting that R-loops promote repeat instability. Nosotros speculated previously that R-loops might raise hairpin formation in the nontemplate strand [23], [32]. Since hairpins block RNAPII, we expected that depletion of RNase H1 and RNase H2A would increase hairpin formation and RNAPII stalling, and thus increase cell death. To examination whether depletion of RNase H enzymes would increment cell death, we used siRNAs to knockdown RNase H1 and RNase H2A. Knockdown of either RNase H1 or RNase 2A alone did not essentially touch jail cell death in DIT7 cells or in DIT7-R103 cells; however, their double knockdown significantly increased cell expiry in both cell lines (Figure v). Again, the normalized effect of the double knockdown on cell death was greater in DIT7-R103 (CAG₁₅) cells than in DIT7 (CAG₉₅) cells (Tabular array 1).

Figure 5. Effects of RNase H knockdown on convergent transcription-induced cell death.

(A) siRNA knockdowns in DIT7 cells. Frequencies of cell decease are: vimentin, 47%; RNase H1-ane, 49%; RNase H2A-1, 46%; RNase H1-1 plus RNase H2A-1, 54%. (B) siRNA knockdowns in DIT7-R103 cells. Frequencies of cell death are: vimentin, 22%; RNase H1-one, 27%; RNase H2A-1, 28%; RNase H1-1 plus RNase H2A-1, 44%. Frequency of jail cell death was calculated as the number of nonadherent cells divided by the sum of adherent and nonadherent cells. Information are the boilerplate frequency of cell death from at least six contained siRNA knockdown experiments. Error bars bespeak standard deviations. Statistical significance relative to the vimentin command is indicated: *P<0.05; **P<0.001; ***P<0.0001.

https://doi.org/10.1371/journal.pone.0046807.g005

MSH2, XPA, and RNase H Modulate Convergent Transcription-induced Echo Wrinkle

In human cells, both TC-NER and mismatch recognition past MSH2/MSH3 are required for echo contraction induced by sense transcription through the repeat tract, since knockdown of any of the individual components reduces the frequency of transcription-induced CAG repeat contraction [18]. By contrast, RNase H, via its ability to eliminate R-loops, helps to forestall transcription-induced repeat contraction [32]. Since convergent transcription stimulates repeat instability synergistically relative to sense or antisense transcription alone [35], it was unclear whether TC-NER, mismatch recognition, and R-loops would accept the same effect on convergent-transcription-induced repeat contraction every bit they exercise on instability induced by sense transcription. To exam these processes, nosotros measured the CAG contraction frequencies in DIT7 (CAG₉₅) cells after knockdown of XPA, MSH2, or RNase H enzymes in cells induced for convergent transcription. As shown in Figure 6, knockdown of XPA or MSH2 significantly reduced wrinkle frequencies, while simultaneous knockdown of RNase H1 and RNase H2A significantly enhanced the contraction frequency. These results suggest that convergent transcription-induced echo instability, like that induced past sense transcription lonely, besides depends on TC-NER and mismatch recognition, and is enhanced past R-loops.

Figure 6. Furnishings of knockdowns of MSH2, XPA and RNase H on convergent transcription-induced CAG repeat contraction.

Contraction frequencies were calculated as the number of HPRT⁺ colonies divided by the number of viable cells, averaged over at to the lowest degree 6 independent siRNA knockdown experiments. Error confined indicate standard deviations. Statistical significance relative to the vimentin control is indicated: *P<0.05; **P<0.01.

https://doi.org/x.1371/journal.pone.0046807.g006

Discussion

Antisense transcripts are common in human genes [39], suggesting that head-to-head, convergent transcription may be a frequent occurrence on human chromosomes. Antisense transcripts have been plant in several trinucleotide repeats (TNR) disease genes, with viii identified in vivo [17], [40], [41], [42], [43], [44], [45], [46] and at to the lowest degree 10 others in human cell lines [47]. Previously, we examined the biological consequences of convergent transcription through a CAG tract, showing that it promotes repeat instability and causes massive cell death [35]. Hither, nosotros have examined the influences of three Deoxyribonucleic acid metabolic processes on convergent transcription-induced cell decease and echo instability. The TC-NER pathway of Deoxyribonucleic acid repair, the mismatch repair recognition component MSH2, and the RNase H species involved in R-loop resolution, which were first identified every bit playing critical roles in echo instability induced by sense transcription [18], [23], [32], all affect the repeat instability and jail cell death induced by convergent transcription. These results advise that a common construction, generated by convergent transcription through a CAG repeat tract, is probable to exist ultimately responsible for both repeat instability and jail cell decease.

For sense transcription-induced repeat instability, we suggested that transcription immune slipped duplexes to form with looped out CAG and CTG segments [22], [23], and that R-loops enhanced the germination of these aberrant structures [32]. Stabilization of CAG and CTG loops by MSH2/MSH3 (MutSβ) binding tin block the progress of RNAPII [24], [25], thereby creating a bespeak that called TC-NER into play to resolve the cake [22], [24], [48]. This working model was created to exist consistent with the results from siRNA knockdowns. Depletion of RNase H, which would increase the lifetime of R-loops, would be expected to increment the germination of slipped duplexes, leading to more than repeat instability, equally observed [32]. Knockdown of MSH2, which would decrease binding to and stabilization of CAG and CTG loops, would reduce stalling of RNAPII, leading to the observed decrease in repeat instability [18]. Knocking down of components of TC-NER prevent the resolution of the block, which is the mechanism by which the repeat is rendered unstable, and thus decrease repeat instability [23]. Here nosotros take shown that this same reasoning applies to convergent transcription-induced repeat instability.

We take speculated elsewhere [35] that convergent transcription through a echo tract can generate aberrant structures with stalled RNAPII complexes on both strands, creating what we take termed a double bubble [36]. Because the structures on each strand are coordinating to the i described to a higher place for sense transcription, it was our expectation that knockdown of RNase H, MSH2, and TC-NER would produce the same effects on repeat instability induced by convergent transcription as they exercise on echo instability induced by sense transcription. Our results match these expectations: depletion of RNase H increases instability, while depletion of MSH2 and TC-NER decrease repeat instability.

The more surprising upshot of convergent transcription through a CAG repeat tract–massive cell decease–depends on simultaneous induction of both sense and antisense transcription on either side of a CAG repeat tract, so that converging RNAPII complexes encounter the same tract [35]. The resulting double bubble, produced past stalled RNAPII complexes on both strands, must present some significant complexity for the jail cell, which induces an ATR response and triggers cell expiry, ii consequences that are not associated with sense transcription solitary [35], [36]. At the beginning, it was unclear whether the processes involved in convergent transcription-induced repeat instability would as well be involved in the associated cell decease. Our knockdown experiments show clearly, nevertheless, that RNase H, MSH2, and TC-NER are all involved in both echo instability and cell death. We tin interpret our results in terms of the likely furnishings on the formation or persistence of the convergent transcription-induced double chimera. Knockdown of RNase H increases R-loops, which favors formation of the slipped duplexes that are primal to formation of the double bubbles, thereby increasing the structure formation and increasing prison cell death. Knockdown of MSH2 prevents stabilization of the CAG and CTG loops, thereby decreasing structure formation and cell expiry. Similarly, knockdown of MSH3 also reduces prison cell death, while double knockdown of MSH2 and MSH3 reduces cell death to the same level every bit either unmarried knockdown (information not shown), consistent with MutSβ playing a part in the stabilization of CAG and CTG loops [25], [26]. Finally, depletion of TC-NER components prevents resolution of the block to RNAPII, prolonging the aberrant structure and increasing cell death.

I striking feature of the effects of siRNA knockdowns on cell death is that DIT7-R103 cells, which carry a short repeat (CAG_fifteen), are more strongly affected than DIT7 cells, which comport a long repeat (CAG₉₅). This counterintuitive outcome cannot exist due to different locations of the repeat in the genome, for example, because DIT7-R103 cells were derived from DIT7 cells by contraction of the echo. Although we practice not know the ground for the difference, we speculate that it reflects the different numbers of CAG and CTG loops that tin form in the two repeats. The long CAG tract can potentially course multiple loops, consistent with our measurements of single-stranded regions inside the tract [32], while the brusk tract is unlikely to form more than one. Reduction of MSH2, for case, would reduce the number of stabilized loops in a tract. If the tract has multiple loops, however, some may still exist stabilized, resulting in a small effect on cell death. By contrast, in a tract with a single loop, reduction of MSH2 would decrease the number of cells in which the loop is stabilized, thereby reducing cell death. Like arguments tin be fabricated for the furnishings of knockdowns of RNase H and TC-NER, both of which would be expected to increase the number of stabilized loops. If cells with long repeats already have multiple stabilized loops, an increment may have footling issue on cell death, whereas in cells with a single repeat, knockdowns may increment the proportion of cells with a stabilized loop, resulting in more than substantial increases in prison cell death.

Our results are consistent with the idea that the stalled RNAPII is the original indicate triggering cell death during convergent transcription [17]. Previous studies showed that agents such as UV light, actinomycin D, psoralen, or antibodies against the RNAPII elongation complex–all of which interfere with transcription by blocking RNAPII genome wide–can stimulate apoptosis [49], [fifty], [51], [52]. Both genome-wide arrest of RNAPII and its stalling at CAG tracts stimulate a cellular response via the ATR signaling pathway [35], [49]. It is remarkable that RNAPII arrested at a unmarried locus in the genome has such a similar effect on cells as genome-wide transcriptional interference, which occurs at thousands of actively transcribed genes. The critical characteristic of this locus appears to be the ability of CAG repeats to form abnormal secondary structures capable of blocking transcription on both template strands. It is not even so clear whether convergent transcription-induced cell death is unique to CAG repeats, or is a more full general aspect of other structure-forming repeats, as well. Supporting this possibility is the observation that transcription stalls at other types of repeat tracts and at Dna sequences that can form secondary structures in vitro [53], [54], [55], [56], [57]; thus, noncanonical Dna structures can cause issues for RNAP.

The pathogenic mechanisms of CAG diseases are complicated and announced to include toxic proteins and RNA molecules [two], [36], [58], [59]. Convergent transcription-induced cell death raises the possibility that DNA toxicity may as well contribute to pathogenesis of these diseases. Nosotros showed previously that convergent transcription through CAG repeats tin can trigger jail cell death in both proliferating and nonproliferating cells [35], indicating that it is a potential mechanism of jail cell death in the terminally differentiated cells that are afflicted in echo diseases. In improver, antisense transcripts take been constitute for several TNR affliction genes, supporting the idea that convergent transcription occurs in vivo and could potentially affect cell health. The contribution of convergent transcription to the pathogenesis of repeat diseases, however, remains to exist tested.

In summary, we have shown that TC-NER pathway, MSH2, and R-loops modulate convergent transcription-induced repeat instability and prison cell death in human cells. These observations link the mechanisms of convergent transcription-induced echo instability and convergent transcription-induced jail cell death, suggesting that a common construction may trigger both outcomes.

Acknowledgments

We thank members of the Wilson lab for helpful discussions.

Writer Contributions

Conceived and designed the experiments: YL JHW. Performed the experiments: YL. Analyzed the data: YL JHW. Wrote the paper: YL JHW.

References

1. ane. Venter JC, Adams MD, Myers EW, Li PW, Mural RJ, et al. (2001) The sequence of the human genome. Scientific discipline 291: 1304–1351.
   • View Article
   • Google Scholar
2. 2. La Spada AR, Taylor JP (2010) Echo expansion disease: progress and puzzles in illness pathogenesis. Nat Rev Genet eleven: 247–258.
   • View Article
   • Google Scholar
3. 3. Orr HT, Zoghbi HY (2007) Trinucleotide repeat disorders. Annu Rev Neurosci 30: 575–621.
   • View Article
   • Google Scholar
4. iv. Gatchel JR, Zoghbi HY (2005) Diseases of unstable repeat expansion: mechanisms and common principles. Nat Rev Genet half dozen: 743–755.
   • View Article
   • Google Scholar
5. 5. Pearson CE, Edamura KN, Cleary JD (2005) Repeat instability: mechanisms of dynamic mutations. Nat Rev Genet six: 729–742.
   • View Article
   • Google Scholar
6. 6. Waterland RA, Dolinoy DC, Lin JR, Smith CA, Shi X, et al. (2006) Maternal methyl supplements increase offspring Dna methylation at Axin Fused. Genesis 44: 401–406.
   • View Commodity
   • Google Scholar
7. 7. Swami Yard, Hendricks AE, Gillis T, Massood T, Mysore J, et al. (2009) Somatic expansion of the Huntington'south disease CAG echo in the brain is associated with an before age of disease onset. Hum Mol Genet 18: 3039–3047.
   • View Article
   • Google Scholar
8. 8. Cleary JD, Pearson CE (2003) The contribution of cis-elements to disease-associated repeat instability: clinical and experimental evidence. Cytogenet Genome Res 100: 25–55.
   • View Article
   • Google Scholar
9. 9. Pelletier R, Farrell BT, Miret JJ, Lahue RS (2005) Mechanistic features of CAG*CTG repeat contractions in cultured cells revealed by a novel genetic assay. Nucleic Acids Res 33: 5667–5676.
   • View Article
   • Google Scholar
10. 10. Wells RD, Dere R, Hebert ML, Napierala G, Son LS (2005) Advances in mechanisms of genetic instability related to hereditary neurological diseases. Nucleic Acids Res 33: 3785–3798.
    • View Commodity
    • Google Scholar
11. 11. Mirkin SM (2007) Expandable DNA repeats and human disease. Nature 447: 932–940.
    • View Article
    • Google Scholar
12. 12. McMurray CT (2010) Mechanisms of trinucleotide repeat instability during human evolution. Nat Rev Genet 11: 786–799.
    • View Article
    • Google Scholar
13. 13. Riley Exist, Orr HT (2006) Polyglutamine neurodegenerative diseases and regulation of transcription: assembling the puzzle. Genes Dev 20: 2183–2192.
    • View Article
    • Google Scholar
14. xiv. Dion V, Lin Y, Hubert L Jr, Waterland RA, Wilson JH (2008) Dnmt1 deficiency promotes CAG repeat expansion in the mouse germline. Hum Mol Genet 17: 1306–1317.
    • View Article
    • Google Scholar
15. 15. Kovtun Iv, Johnson KO, McMurray CT (2011) Cockayne syndrome B protein antagonizes OGG1 in modulating CAG echo length in vivo. Aging (Albany NY) 3: 509–514.
    • View Article
    • Google Scholar
16. 16. Kovtun Iv, Liu Y, Bjoras M, Klungland A, Wilson SH, et al. (2007) OGG1 initiates age-dependent CAG trinucleotide expansion in somatic cells. Nature 447: 447–452.
    • View Article
    • Google Scholar
17. 17. Hubert L Jr, Lin Y, Dion V, Wilson JH (2011) Xpa deficiency reduces CAG trinucleotide echo instability in neuronal tissues in a mouse model of SCA1. Hum Mol Genet 20: 4822–4830.
    • View Article
    • Google Scholar
18. 18. Lin Y, Dion Five, Wilson JH (2006) Transcription promotes contraction of CAG repeat tracts in human cells. Nat Struct Mol Biol 13: 179–180.
    • View Commodity
    • Google Scholar
19. 19. Jung J, Bonini N (2007) CREB-binding protein modulates echo instability in a Drosophila model for polyQ affliction. Science 315: 1857–1859.
    • View Article
    • Google Scholar
20. xx. Pearson CE, Sinden RR (1996) Alternative structures in duplex Deoxyribonucleic acid formed within the trinucleotide repeats of the myotonic dystrophy and fragile Ten loci. Biochemistry 35: 5041–5053.
    • View Article
    • Google Scholar
21. 21. Gacy AM, Goellner Grand, Juranic North, Macura S, McMurray CT (1995) Trinucleotide repeats that expand in human illness class hairpin structures in vitro. Cell 81: 533–540.
    • View Commodity
    • Google Scholar
22. 22. Lin Y, Hubert 50 Jr, Wilson JH (2009) Transcription destabilizes triplet repeats. Mol Carcinog 48: 350–361.
    • View Article
    • Google Scholar
23. 23. Lin Y, Wilson JH (2007) Transcription-induced CAG echo contraction in human cells is mediated in part by transcription-coupled nucleotide excision repair. Mol Prison cell Biol 27: 6209–6217.
    • View Article
    • Google Scholar
24. 24. Salinas-Rios V, Belotserkovskii BP, Hanawalt PC (2011) Deoxyribonucleic acid skid-outs cause RNA polymerase Ii arrest in vitro: potential implications for genetic instability. Nucleic Acids Res 39: 7444–7454.
    • View Article
    • Google Scholar
25. 25. Owen BA, Yang Z, Lai M, Gajek Chiliad, Badger JD, 2nd, et al (2005) (CAG)(north)-hairpin DNA binds to Msh2-Msh3 and changes properties of mismatch recognition. Nat Struct Mol Biol 12: 663–670.
    • View Article
    • Google Scholar
26. 26. Pearson CE, Ewel A, Acharya S, Fishel RA, Sinden RR (1997) Human MSH2 binds to trinucleotide repeat Deoxyribonucleic acid structures associated with neurodegenerative diseases. Hum Mol Genet vi: 1117–1123.
    • View Article
    • Google Scholar
27. 27. Kovtun IV, McMurray CT (2001) Trinucleotide expansion in haploid germ cells by gap repair. Nat Genet 27: 407–411.
    • View Article
    • Google Scholar
28. 28. Manley Thousand, Shirley TL, Flaherty Fifty, Messer A (1999) Msh2 deficiency prevents in vivo somatic instability of the CAG repeat in Huntington disease transgenic mice. Nat Genet 23: 471–473.
    • View Commodity
    • Google Scholar
29. 29. Savouret C, Brisson E, Essers J, Kanaar R, Pastink A, et al. (2003) CTG repeat instability and size variation timing in Dna repair-deficient mice. Embo J 22: 2264–2273.
    • View Article
    • Google Scholar
30. xxx. Savouret C, Garcia-Cordier C, Megret J, te Riele H, Junien C, et al. (2004) MSH2-dependent germinal CTG repeat expansions are produced continuously in spermatogonia from DM1 transgenic mice. Mol Cell Biol 24: 629–637.
    • View Article
    • Google Scholar
31. 31. Lin Y, Wilson JH (2009) Diverse effects of private mismatch repair components on transcription-induced CAG repeat instability in human cells. Deoxyribonucleic acid Repair (Amst) viii: 878–885.
    • View Article
    • Google Scholar
32. 32. Lin Y, Dent SY, Wilson JH, Wells RD, Napierala M (2010) R loops stimulate genetic instability of CTG.CAG repeats. Proc Natl Acad Sci U South A 107: 692–697.
    • View Commodity
    • Google Scholar
33. 33. Hubert L Jr, Lin Y, Dion Five, Wilson JH (2011) Topoisomerase one and Unmarried-Strand Intermission Repair Modulate Transcription-Induced CAG Repeat Wrinkle in Homo Cells. Mol Cell Biol 31: 3105–3112.
    • View Article
    • Google Scholar
34. 34. Nakamori M, Pearson CE, Thornton CA (2011) Bidirectional transcription stimulates expansion and contraction of expanded (CTG)*(CAG) repeats. Hum Mol Genet 20: 580–588.
    • View Article
    • Google Scholar
35. 35. Lin Y, Leng Thou, Wan M, Wilson JH (2010) Convergent transcription through a long CAG tract destabilizes repeats and induces apoptosis. Mol Jail cell Biol thirty: 4435–4451.
    • View Article
    • Google Scholar
36. 36. Lin Y, Wilson JH (2011) Transcription-induced DNA toxicity at trinucleotide repeats: double bubble is problem. Cell Wheel x: 611–618.
    • View Commodity
    • Google Scholar
37. 37. Camenisch U, Dip R, Schumacher SB, Schuler B, Naegeli H (2006) Recognition of helical kinks past xeroderma pigmentosum group A protein triggers Dna excision repair. Nat Struct Mol Biol 13: 278–284.
    • View Article
    • Google Scholar
38. 38. Oussatcheva EA, Hashem VI, Zou Y, Sinden RR, Potaman VN (2001) Involvement of the nucleotide excision repair protein UvrA in instability of CAG*CTG repeat sequences in Escherichia coli. J Biol Chem 276: 30878–30884.
    • View Article
    • Google Scholar
39. 39. Katayama S, Tomaru Y, Kasukawa T, Waki K, Nakanishi Grand, et al. (2005) Antisense transcription in the mammalian transcriptome. Scientific discipline 309: 1564–1566.
    • View Commodity
    • Google Scholar
40. twoscore. Wilburn B, Rudnicki DD, Zhao J, Weitz TM, Cheng Y, et al. (2011) An antisense CAG repeat transcript at JPH3 locus mediates expanded polyglutamine poly peptide toxicity in Huntington's disease-like two mice. Neuron 70: 427–440.
    • View Article
    • Google Scholar
41. 41. Moseley ML, Zu T, Ikeda Y, Gao W, Mosemiller AK, et al. (2006) Bidirectional expression of CUG and CAG expansion transcripts and intranuclear polyglutamine inclusions in spinocerebellar clutter type 8. Nat Genet 38: 758–769.
    • View Article
    • Google Scholar
42. 42. Ladd PD, Smith LE, Rabaia NA, Moore JM, Georges SA, et al. (2007) An antisense transcript spanning the CGG repeat region of FMR1 is upregulated in premutation carriers but silenced in full mutation individuals. Hum Mol Genet sixteen: 3174–3187.
    • View Article
    • Google Scholar
43. 43. Cho DH, Thienes CP, Mahoney SE, Analau E, Filippova GN, et al. (2005) Antisense transcription and heterochromatin at the DM1 CTG repeats are constrained by CTCF. Mol Cell 20: 483–489.
    • View Article
    • Google Scholar
44. 44. Chung DW, Rudnicki DD, Yu 50, Margolis RL (2011) A natural antisense transcript at the Huntington'southward illness repeat locus regulates HTT expression. Hum Mol Genet 20: 3467–3477.
    • View Article
    • Google Scholar
45. 45. De Biase I, Chutake YK, Rindler PM, Bidichandani SI (2009) Epigenetic silencing in Friedreich ataxia is associated with depletion of CTCF (CCCTC-bounden factor) and antisense transcription. PLoS One four: e7914.
    • View Article
    • Google Scholar
46. 46. Sopher BL, Ladd PD, Pineda VV, Libby RT, Sunkin SM, et al. (2011) CTCF regulates ataxin-seven expression through promotion of a convergently transcribed, antisense noncoding RNA. Neuron seventy: 1071–1084.
    • View Commodity
    • Google Scholar
47. 47. He Y, Vogelstein B, Velculescu VE, Papadopoulos N, Kinzler KW (2008) The antisense transcriptomes of human cells. Science 322: 1855–1857.
    • View Article
    • Google Scholar
48. 48. Kim N, Jinks-Robertson Southward (2012) Transcription as a source of genome instability. Nat Rev Genet 13: 204–214.
    • View Article
    • Google Scholar
49. 49. Derheimer FA, O'Hagan HM, Krueger HM, Hanasoge S, Paulsen MT, et al. (2007) RPA and ATR link transcriptional stress to p53. Proc Natl Acad Sci U Due south A 104: 12778–12783.
    • View Article
    • Google Scholar
50. fifty. Ljungman M (2007) The transcription stress response. Cell Bike 6: 2252–2257.
    • View Article
    • Google Scholar
51. 51. Ljungman One thousand, Lane DP (2004) Transcription - guarding the genome by sensing Deoxyribonucleic acid damage. Nat Rev Cancer four: 727–737.
    • View Article
    • Google Scholar
52. 52. Arima Y, Nitta M, Kuninaka Southward, Zhang D, Fujiwara T, et al. (2005) Transcriptional blockade induces p53-dependent apoptosis associated with translocation of p53 to mitochondria. J Biol Chem 280: 19166–19176.
    • View Article
    • Google Scholar
53. 53. Belotserkovskii BP, De Silva E, Tornaletti Due south, Wang G, Vasquez KM, et al. (2007) A triplex-forming sequence from the man c-MYC promoter interferes with DNA transcription. J Biol Chem 282: 32433–32441.
    • View Article
    • Google Scholar
54. 54. Ditlevson JV, Tornaletti S, Belotserkovskii BP, Teijeiro Five, Wang G, et al. (2008) Inhibitory result of a short Z-Dna forming sequence on transcription elongation by T7 RNA polymerase. Nucleic Acids Res 36: 3163–3170.
    • View Article
    • Google Scholar
55. 55. Grabczyk Eastward, Usdin G (2000) The GAA*TTC triplet repeat expanded in Friedreich's ataxia impedes transcription elongation by T7 RNA polymerase in a length and supercoil dependent style. Nucleic Acids Res 28: 2815–2822.
    • View Article
    • Google Scholar
56. 56. Parsons MA, Sinden RR, Izban MG (1998) Transcriptional properties of RNA polymerase II within triplet repeat-containing DNA from the human myotonic dystrophy and fragile 10 loci. J Biol Chem 273: 26998–27008.
    • View Article
    • Google Scholar
57. 57. Tornaletti Due south, Park-Snyder S, Hanawalt PC (2008) G4-forming sequences in the non-transcribed DNA strand pose blocks to T7 RNA polymerase and mammalian RNA polymerase II. J Biol Chem 283: 12756–12762.
    • View Article
    • Google Scholar
58. 58. Lawlor KT, O'Keefe LV, Samaraweera SE, van Eyk CL, McLeod CJ, et al. (2011) Double-stranded RNA is pathogenic in Drosophila models of expanded echo neurodegenerative diseases. Hum Mol Genet twenty: 3757–3768.
    • View Article
    • Google Scholar
59. 59. Osborne RJ, Thornton CA (2006) RNA-dominant diseases. Hum Mol Genet xv Spec No 2: R162–169.
    • View Article
    • Google Scholar

Mismatch Repair Involves The Methylation Of Which Combination Of 4 Nucleotides?,

Source: https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0046807

Posted by: petersonairming1965.blogspot.com

Share this post